digplanet beta 1: Athena
Share digplanet:

Agriculture

Applied sciences

Arts

Belief

Business

Chronology

Culture

Education

Environment

Geography

Health

History

Humanities

Language

Law

Life

Mathematics

Nature

People

Politics

Science

Society

Technology

In molecular biology and bioinformatics, the consensus sequence is the calculated order of most frequent residues, either nucleotide or amino acid, found at each position in a sequence alignment. It represents the results of multiple sequence alignments in which related sequences are compared to each other and similar sequence motifs are calculated. Such information is important when considering sequence-dependent enzymes such as RNA polymerase.[1]

Biological significance[edit]

A protein binding site, represented by a consensus sequence, may be a short sequence of nucleotides which is found several times in the genome and is thought to play the same role in its different locations. For example, many transcription factors recognize particular patterns in the promoters of the genes they regulate. In the same way restriction enzymes usually have palindromic consensus sequences, usually corresponding to the site where they cut the DNA. Transposons act in much the same manner in their identification of target sequences for transposition. Finally splice sites (sequences immediately surrounding the exon-intron boundaries) can also be considered as consensus sequences.

Thus a consensus sequence is a model for a putative DNA binding site: it is obtained by aligning all known examples of a certain recognition site and defined as the idealized sequence that represents the predominant base at each position. All the actual examples shouldn't differ from the consensus by more than a few substitutions, but counting mismatches in this way can lead to inconsistencies.[2]

Any mutation allowing a mutated nucleotide in the core promoter sequence to look more like the consensus sequence is known as an up mutation. This kind of mutation will generally make the promoter stronger, and thus the RNA polymerase forms a tighter bind to the DNA it wishes to transcribe and transcription is up-regulated. On the contrary, mutations that destroy conserved nucleotides in the consensus sequence are known as down mutations. These types of mutations down-regulate transcription since RNA polymerase can no longer bind as tightly to the core promoter sequence.

Sequence analysis[edit]

Developing software for pattern recognition is a major topic in genetics, molecular biology, and bioinformatics. Specific sequence motifs can function as regulatory sequences controlling biosynthesis, or as signal sequences that direct a molecule to a specific site within the cell or regulate its maturation. Since the regulatory function of these sequences is important, they are thought to be conserved across long periods of evolution. In some cases, evolutionary relatedness can be estimated by the amount of conservation of these sites.

Notation[edit]

The conserved sequence motifs are called consensus sequences and they show which residues are conserved and which residues are variable. Consider the following example DNA sequence:

A[CT]N{A}YR

In this notation, A means that an A is always found in that position; [CT] stands for either C or T; N stands for any base; and {A} means any base except A. Y represents any pyrimidine, and R indicates any purine.

In this example, the notation [CT] does not give any indication of the relative frequency of C or T occurring at that position. An alternative method of representing a consensus sequence uses a sequence logo. This is a graphical representation of the consensus sequence, in which the size of a symbol is related to the frequency that a given nucleotide (or amino acid) occurs at a certain position. In sequence logos the more conserved the residue, the larger the symbol for that residue is drawn; the less frequent, the smaller the symbol. Sequence logos can be generated using WebLogo, or using the Gestalt Workbench, a publicly available visualization tool written by Gustavo Glusman at the Institute for Systems Biology.[2]

Software[edit]

Bioinformatics tools are able to calculate and visualize consensus sequences. Examples of the tools are JalView and UGENE.

See also[edit]

References[edit]

  1. ^ Pierce, Benjamin A. 2002. Genetics : A Conceptual Approach. 1st ed. New York: W.H. Freeman and Co.
  2. ^ a b Schneider TD (2002). "Consensus Sequence Zen". Appl Bioinformatics 1 (3): 111–119. PMC 1852464. PMID 15130839. 

Original courtesy of Wikipedia: http://en.wikipedia.org/wiki/Consensus_sequence — Please support Wikipedia.
This page uses Creative Commons Licensed content from Wikipedia. A portion of the proceeds from advertising on Digplanet goes to supporting Wikipedia.
4817 videos foundNext > 

What is DNA consensus sequence?

Here is my another video about DNA Consensus Sequence: https://www.youtube.com/watch?v=Rgg1bmRpfj0 In molecular biology and bioinformatics, the ...

12 l Consensus Sequence

Transcription initiation in prokaryotes | prokaryotic transcription lecture 2

Transcription initiation in prokaryotes – This lecture explains about the prokaryotic transcription initiation. The nucleotide pair within the DNA double helix that ...

Prokaryotic Transcription and Promoters

Kozak consensus sequence

The Kozak consensus sequence, Kozak consensus or Kozak sequence, is a sequence which occurs on eukaryotic mRNA and has the consensus ...

Consensus sequence - probability problem

Here is my another video about what is DNA Consensus Sequence: https://youtu.be/4HYJILahPw4.

Consensus Sequence - Tales from the Genome

This video is part of an online course, Tales from the Genome. Check out the course here: https://www.udacity.com/course/bio110.

DNASTAR - Creating a New Consensus for an Alignment

DNASTAR's MegAlign application allows you to define multiple consensus sequences from the alignment report, enabling the comparison of the sequences in ...

Lecture 11. Unit 1 Sequence Consensus and Multi-Paxos

This lecture is about sequence consensus and multi-Paxos. In fact about a variant that is extremely efficient that we call Sequence Paxos. This version is also ...

Medical vocabulary: What does Consensus Sequence mean

What does Consensus Sequence mean in English?

4817 videos foundNext > 

202 news items

Nature.com

Nature.com
Mon, 08 Feb 2016 09:02:58 -0800

Site-directed mutagenesis demonstrates that POFUT2 fucosylates threonine preferentially over serine and relies on folded TSRs containing the minimal consensus sequence C-X-X-S/T-C. Crystallographic and mutagenesis data, together with atomic-level ...

Nature.com

Nature.com
Mon, 08 Feb 2016 08:41:15 -0800

The method calls both DNA methylation polymorphisms and SNPs from the same bisulfite-converted samples while reconstructing the consensus sequence of the targeted genomic loci. Common protocols for RRBS call for MspI digestion of genomic DNA ...

Nature.com

Nature.com
Mon, 08 Feb 2016 03:03:16 -0800

Oligonucleotides containing the AP-1 consensus sequence (CGCTTGATGACTCAGCCGGAA), as well as synthetic, single-stranded phosphorothioate ODNs specific for AP-1, together with matching mutated ODN, were synthesized by MWG Biotech (Monza, ...

Nature.com

Nature.com
Wed, 03 Feb 2016 23:18:45 -0800

This mutation abolishes the normal splice-site consensus sequence leading to the use of an alternative (cryptic) splice in the adjacent intron. It is predictable that this partial intronic retention creates a premature termination codon and thus a ...

Nature.com

Nature.com
Mon, 25 Jan 2016 03:29:10 -0800

Interestingly, we discovered a potential p38 phosphorylation site harbored within a consensus sequence on human FOXC2 protein (Figure 5g). We next investigated the functional relevance of this putative site in facilitating FOXC2-mediated stem-cell ...

Nature.com

Nature.com
Mon, 01 Feb 2016 02:52:30 -0800

Interestingly, other mammalian species including mouse exhibit a caspase consensus sequence surrounding D139 (Figure 3d). To investigate p27 cleavage upon induced cell death in primary cells and to investigate caspase processing of murine p27, we ...

Nature.com

Nature.com
Tue, 26 Jan 2016 06:40:26 -0800

The GAD1 gene has a consensus sequence for the transcription factor Egr-1 in its promoter, and Egr-1 has been shown before to regulate the GAD1 promoter. Testing the hypothesis that indirect effects might contribute to GAD67 regulation by HDAC1/DAXX, ...

Nature.com

Nature.com
Tue, 02 Feb 2016 02:41:15 -0800

At the 3′ end of the pseudoexon, the splice donor sequence conforms well with a described consensus sequence. To test whether the incorporation of the pseudoexon in NZB Nlrp3 mRNA is the sole reason for the profound NLRP3 deficiency, AONs were ...
Loading

Oops, we seem to be having trouble contacting Twitter

Support Wikipedia

A portion of the proceeds from advertising on Digplanet goes to supporting Wikipedia. Please add your support for Wikipedia!

Searchlight Group

Digplanet also receives support from Searchlight Group. Visit Searchlight